ID: 1042454478_1042454479

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1042454478 1042454479
Species Human (GRCh38) Human (GRCh38)
Location 8:68984669-68984691 8:68984688-68984710
Sequence CCACAAAAATGTGCAGTGATCTA TCTATCAAACTACATCATCCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 8, 4: 122}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!