ID: 1042517193_1042517196

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1042517193 1042517196
Species Human (GRCh38) Human (GRCh38)
Location 8:69671912-69671934 8:69671927-69671949
Sequence CCAGTGCTTTCAAGATGTAACTA TGTAACTAAAATACTCAGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 153} {0: 1, 1: 0, 2: 0, 3: 14, 4: 156}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!