ID: 1042517280_1042517291

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1042517280 1042517291
Species Human (GRCh38) Human (GRCh38)
Location 8:69672883-69672905 8:69672923-69672945
Sequence CCAAGGCAGCGGGGCTCTCTTCC GGAACTTATTGCTTCTGGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 142} {0: 1, 1: 0, 2: 0, 3: 14, 4: 173}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!