ID: 1042711600_1042711604

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1042711600 1042711604
Species Human (GRCh38) Human (GRCh38)
Location 8:71723391-71723413 8:71723430-71723452
Sequence CCTTTCCCAATTTGTGGCTCTGA TACACCTGTATGGCCACAGCTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!