ID: 1042733806_1042733809

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1042733806 1042733809
Species Human (GRCh38) Human (GRCh38)
Location 8:71965335-71965357 8:71965355-71965377
Sequence CCTTGGTGCTGTCCTCTCGATGG TGGTGAGTTCTCGTGAGATCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 15, 3: 125, 4: 517} {0: 1, 1: 49, 2: 617, 3: 1747, 4: 2672}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!