ID: 1043462822_1043462826

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1043462822 1043462826
Species Human (GRCh38) Human (GRCh38)
Location 8:80478043-80478065 8:80478057-80478079
Sequence CCAGATAGTTCTCAAAGCAAATG AAGCAAATGTGAAGGAGGGAAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 5, 3: 68, 4: 843}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!