ID: 1044085281_1044085291

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1044085281 1044085291
Species Human (GRCh38) Human (GRCh38)
Location 8:87936072-87936094 8:87936118-87936140
Sequence CCCCATCACAGGGCATGCGATGG CCCCACTGCTCAAATCTCTTGGG
Strand - +
Off-target summary No data {0: 1, 1: 5, 2: 69, 3: 168, 4: 371}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!