ID: 1044569434_1044569448

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1044569434 1044569448
Species Human (GRCh38) Human (GRCh38)
Location 8:93700682-93700704 8:93700707-93700729
Sequence CCGAGCCCAGCTGCCCAGGGCCG CACACTGGAGGGCTGGGGTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 59, 4: 531} {0: 1, 1: 0, 2: 8, 3: 93, 4: 832}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!