ID: 1044831902_1044831903

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1044831902 1044831903
Species Human (GRCh38) Human (GRCh38)
Location 8:96258873-96258895 8:96258890-96258912
Sequence CCAACAACAAGGCAATCTCAGTT TCAGTTACAAACCAACAGACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 130} {0: 1, 1: 0, 2: 1, 3: 7, 4: 137}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!