ID: 1044911628_1044911631

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1044911628 1044911631
Species Human (GRCh38) Human (GRCh38)
Location 8:97065950-97065972 8:97065987-97066009
Sequence CCCAAGGAGAAAGCACTGAAGCA AACAATTTTCTCTTGTGTTTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 49, 4: 360} {0: 1, 1: 0, 2: 1, 3: 50, 4: 552}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!