ID: 1045145664_1045145671

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1045145664 1045145671
Species Human (GRCh38) Human (GRCh38)
Location 8:99341088-99341110 8:99341137-99341159
Sequence CCATCCACCATCTCCTTACAAAG ATTATAATGCACCTTCATGTTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 18, 4: 159}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!