ID: 1045277739_1045277749

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1045277739 1045277749
Species Human (GRCh38) Human (GRCh38)
Location 8:100722349-100722371 8:100722364-100722386
Sequence CCCGCGCTGCGTCGCGTCCGTGG GTCCGTGGGGGTGGGGAGGACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 41} {0: 1, 1: 0, 2: 13, 3: 110, 4: 1150}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!