ID: 1045370339_1045370346

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1045370339 1045370346
Species Human (GRCh38) Human (GRCh38)
Location 8:101516445-101516467 8:101516498-101516520
Sequence CCCTCTGTGGCCAGGCTGGAGGG ACCTCGATCTCCCAGGCTCAAGG
Strand - +
Off-target summary No data {0: 1, 1: 20, 2: 272, 3: 1440, 4: 4306}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!