ID: 1046027353_1046027355

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1046027353 1046027355
Species Human (GRCh38) Human (GRCh38)
Location 8:108740867-108740889 8:108740903-108740925
Sequence CCTAAAACTATGTGCAAAATAGT GTTTGTATTGGAAGAAAAGCTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!