ID: 1046644593_1046644595

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1046644593 1046644595
Species Human (GRCh38) Human (GRCh38)
Location 8:116771800-116771822 8:116771813-116771835
Sequence CCCAAAAGTACTTTCTGAGAAGC TCTGAGAAGCAGAATGCAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 36, 4: 295} {0: 1, 1: 0, 2: 0, 3: 41, 4: 509}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!