ID: 1046654009_1046654028

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1046654009 1046654028
Species Human (GRCh38) Human (GRCh38)
Location 8:116874075-116874097 8:116874127-116874149
Sequence CCCCGCCCAGCCCCACCAGCTCC GGCGGAAGGTTGCTGCTCCCGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 21, 3: 169, 4: 1579} {0: 1, 1: 0, 2: 0, 3: 6, 4: 123}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!