ID: 1046670040_1046670047

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1046670040 1046670047
Species Human (GRCh38) Human (GRCh38)
Location 8:117047027-117047049 8:117047062-117047084
Sequence CCTGCTTTTGGCTCAGGTGACCA CACTGTGGATGAGTGGGAGACGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!