ID: 1046900321_1046900324

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1046900321 1046900324
Species Human (GRCh38) Human (GRCh38)
Location 8:119516673-119516695 8:119516707-119516729
Sequence CCATTCTCTAACATCTTTACACT TTGGTAAGAAACAATATTGTTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 30, 4: 305}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!