ID: 1047202889_1047202894

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1047202889 1047202894
Species Human (GRCh38) Human (GRCh38)
Location 8:122781511-122781533 8:122781533-122781555
Sequence CCAGCTCCTGCCTGAAAAATGAC CATTTCGCCGGTGTCTCCGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 214} {0: 1, 1: 0, 2: 0, 3: 0, 4: 25}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!