ID: 1047254838_1047254845

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1047254838 1047254845
Species Human (GRCh38) Human (GRCh38)
Location 8:123207149-123207171 8:123207188-123207210
Sequence CCCTCCAGCTTCACCTGGCTCTG AACATCCTCTCCAAGTTCACAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 41, 4: 406} {0: 1, 1: 0, 2: 2, 3: 22, 4: 194}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!