ID: 1048073159_1048073174

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1048073159 1048073174
Species Human (GRCh38) Human (GRCh38)
Location 8:131041598-131041620 8:131041620-131041642
Sequence CCGCGCCAAGCCACGCCCCCGGA AACCGGGCCGGGGGTGGCGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 12, 4: 220} {0: 1, 1: 0, 2: 4, 3: 64, 4: 616}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!