ID: 1048315497_1048315501

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1048315497 1048315501
Species Human (GRCh38) Human (GRCh38)
Location 8:133358901-133358923 8:133358920-133358942
Sequence CCTAGCAGTGTCCCTGGCAAGGA AGGAACTGCACAGTGGATACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 40, 4: 279} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!