ID: 1048427553_1048427562

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1048427553 1048427562
Species Human (GRCh38) Human (GRCh38)
Location 8:134336827-134336849 8:134336872-134336894
Sequence CCTTGTGTCTCCCCAGATGGGAT CCTGAATTCCAGGAGACACTAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!