ID: 1048457345_1048457347

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1048457345 1048457347
Species Human (GRCh38) Human (GRCh38)
Location 8:134590347-134590369 8:134590383-134590405
Sequence CCTTTTGTCCTTAATAGAAAGAG GACTTTCTCATTTAAATCTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 229} {0: 1, 1: 0, 2: 1, 3: 23, 4: 339}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!