ID: 1048872775_1048872782

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1048872775 1048872782
Species Human (GRCh38) Human (GRCh38)
Location 8:138812767-138812789 8:138812792-138812814
Sequence CCTGCATGGCTTGGCTCCCCCAG CATACCCTAAGCTCCCTCTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 245} {0: 1, 1: 0, 2: 0, 3: 6, 4: 111}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!