ID: 1049025914_1049025920

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1049025914 1049025920
Species Human (GRCh38) Human (GRCh38)
Location 8:139988738-139988760 8:139988776-139988798
Sequence CCGGCGTGCAGGATGAGTGCCTC GACGGTCAGCTCATGCTCGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 84} {0: 1, 1: 0, 2: 0, 3: 2, 4: 43}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!