ID: 1049127305_1049127316

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1049127305 1049127316
Species Human (GRCh38) Human (GRCh38)
Location 8:140803738-140803760 8:140803783-140803805
Sequence CCTGAAGACATCCTCCCTAAGAC GATTCTCCATGCTGCCCCAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 135} {0: 1, 1: 0, 2: 1, 3: 22, 4: 239}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!