ID: 1049377019_1049377028

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1049377019 1049377028
Species Human (GRCh38) Human (GRCh38)
Location 8:142294126-142294148 8:142294149-142294171
Sequence CCCCCTGCGGACCTCAGAGGATG CAGAGTGGCCAGAGGGAAGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 139} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!