ID: 1049383818_1049383830

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1049383818 1049383830
Species Human (GRCh38) Human (GRCh38)
Location 8:142331013-142331035 8:142331040-142331062
Sequence CCCTGCCCCCTGCTACTCCATAT GGCCCCACTGCAGCCCGGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 219} {0: 1, 1: 0, 2: 2, 3: 70, 4: 1504}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!