ID: 1049414457_1049414467

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1049414457 1049414467
Species Human (GRCh38) Human (GRCh38)
Location 8:142488924-142488946 8:142488974-142488996
Sequence CCTTGAAGATGGGCGGCAGATGC GCCAAGTCCCACCCTGGCTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 210} {0: 1, 1: 1, 2: 2, 3: 30, 4: 268}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!