ID: 1049415522_1049415531

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1049415522 1049415531
Species Human (GRCh38) Human (GRCh38)
Location 8:142493174-142493196 8:142493203-142493225
Sequence CCCTTTGTCCTCCAGGGCAGCAG AGGGGCCTGTCCAGTGAGCCGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!