ID: 1049451801_1049451815

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1049451801 1049451815
Species Human (GRCh38) Human (GRCh38)
Location 8:142666023-142666045 8:142666048-142666070
Sequence CCCTCTGCTCTTCCCGGCAGCCG TTGGAGGCCATGGGGAGGGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 174} {0: 1, 1: 1, 2: 4, 3: 95, 4: 745}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!