ID: 1049451950_1049451958

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1049451950 1049451958
Species Human (GRCh38) Human (GRCh38)
Location 8:142666704-142666726 8:142666748-142666770
Sequence CCCTGCACGTGCTGCTCAGGTGG GCAAACTGAAGCCATTCGCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 135} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!