ID: 1049463552_1049463559

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1049463552 1049463559
Species Human (GRCh38) Human (GRCh38)
Location 8:142740945-142740967 8:142740974-142740996
Sequence CCACTCTTGGCTTAGTTATGTTT CGTGGGGTATGGAAGGCAGAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 31, 4: 539} {0: 1, 1: 0, 2: 2, 3: 14, 4: 258}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!