ID: 1049519586_1049519592

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1049519586 1049519592
Species Human (GRCh38) Human (GRCh38)
Location 8:143081074-143081096 8:143081087-143081109
Sequence CCTGTGCACCCTCCCGCTGGCTG CCGCTGGCTGTGGCGTCTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 194} {0: 1, 1: 0, 2: 1, 3: 11, 4: 177}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!