ID: 1049612533_1049612546

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1049612533 1049612546
Species Human (GRCh38) Human (GRCh38)
Location 8:143562150-143562172 8:143562197-143562219
Sequence CCGGGGCACACAAGGCCTGCCCA CCGTGCCCACAGCTGGAGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 291} {0: 1, 1: 0, 2: 1, 3: 25, 4: 241}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!