ID: 1049645281_1049645290

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1049645281 1049645290
Species Human (GRCh38) Human (GRCh38)
Location 8:143733346-143733368 8:143733365-143733387
Sequence CCGTGCCCAGCACCCAGACTCCA TCCAGCTAGGCCGCGAGGGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 76, 4: 632} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!