ID: 1049654863_1049654867

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1049654863 1049654867
Species Human (GRCh38) Human (GRCh38)
Location 8:143792975-143792997 8:143792989-143793011
Sequence CCTGGGCAGGGGCATCCTCAGGC TCCTCAGGCGGGTGAGAAGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 45, 4: 376} {0: 1, 1: 0, 2: 1, 3: 14, 4: 188}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!