ID: 1049693271_1049693277

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1049693271 1049693277
Species Human (GRCh38) Human (GRCh38)
Location 8:143972007-143972029 8:143972030-143972052
Sequence CCCTGGGGCCAGGAAAGCCTCAG CACAATGCCCAGAACAGGCTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 33, 4: 380}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!