ID: 1049695962_1049695969

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1049695962 1049695969
Species Human (GRCh38) Human (GRCh38)
Location 8:143984440-143984462 8:143984487-143984509
Sequence CCATTGCAGAGATGGAGTTTGCA TTGAGTCCCCAGTAGGAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 216} {0: 1, 1: 0, 2: 1, 3: 12, 4: 185}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!