ID: 1049711125_1049711130

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1049711125 1049711130
Species Human (GRCh38) Human (GRCh38)
Location 8:144063829-144063851 8:144063871-144063893
Sequence CCTGGTTCTCCTGGATGAGCTGC CGTTCTCCTGTGCCAGCCGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 42, 4: 253} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!