ID: 1049718807_1049718819

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1049718807 1049718819
Species Human (GRCh38) Human (GRCh38)
Location 8:144106208-144106230 8:144106238-144106260
Sequence CCATGAGTTCAGCCGGGAGCCCA CTGGGTGAGGGTCAGGTGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 126} {0: 1, 1: 0, 2: 5, 3: 62, 4: 747}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!