ID: 1049749475_1049749491

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1049749475 1049749491
Species Human (GRCh38) Human (GRCh38)
Location 8:144276508-144276530 8:144276555-144276577
Sequence CCCTGTCCTCTGTGAGGGCTGGA CCTGGGCTGACACGGGTGTCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 47, 4: 382} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!