ID: 1049787386_1049787395

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1049787386 1049787395
Species Human (GRCh38) Human (GRCh38)
Location 8:144457505-144457527 8:144457547-144457569
Sequence CCCCTCTGCAGATGCTGATACAC CCATTTGCACCTGCATCCTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 171} {0: 1, 1: 1, 2: 1, 3: 23, 4: 157}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!