ID: 1049846252_1049846258

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1049846252 1049846258
Species Human (GRCh38) Human (GRCh38)
Location 8:144803258-144803280 8:144803293-144803315
Sequence CCATCCTCCCTCTCCTGATGCTG TGTTAGAAATTGAGACCCAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 98, 4: 783} {0: 1, 1: 0, 2: 1, 3: 20, 4: 253}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!