ID: 1049936612_1049936617

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1049936612 1049936617
Species Human (GRCh38) Human (GRCh38)
Location 9:505563-505585 9:505581-505603
Sequence CCGGGTCCCGTGGAACTTTCAGA TCAGAGGCAACTGTTCTTGGTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!