ID: 1050150378_1050150386

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1050150378 1050150386
Species Human (GRCh38) Human (GRCh38)
Location 9:2613964-2613986 9:2614014-2614036
Sequence CCCTTACAGCTGACAAATCTAGC GGATGCATAAAGTGACGACTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 107} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!