ID: 1050357086_1050357091

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1050357086 1050357091
Species Human (GRCh38) Human (GRCh38)
Location 9:4793329-4793351 9:4793359-4793381
Sequence CCGGCGAGCGCGTCGGGGAGGGC GCGTCGCCTCCAAAGCCGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 97} {0: 1, 1: 0, 2: 0, 3: 3, 4: 29}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!