ID: 1050601586_1050601598

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1050601586 1050601598
Species Human (GRCh38) Human (GRCh38)
Location 9:7258309-7258331 9:7258340-7258362
Sequence CCACCAATTCCCACCACAAGAGA GCTACAGATGGGAGGGGCTGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 49, 4: 422}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!