ID: 1050601589_1050601597

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1050601589 1050601597
Species Human (GRCh38) Human (GRCh38)
Location 9:7258319-7258341 9:7258339-7258361
Sequence CCACCACAAGAGATTCTTAAAGC AGCTACAGATGGGAGGGGCTGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!